View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_high_97 (Length: 217)
Name: NF1250_high_97
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_high_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 30 - 133
Target Start/End: Original strand, 40853232 - 40853335
Alignment:
| Q |
30 |
aatatgcagagttccggaaaatcgtcggtgttagagagtatcgttggacgtgattttcttccccgtggatcaggtgcattactgtcatcgttttcaccgt |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40853232 |
aatatgcagagttctggaaaatcgtcggtgttagagagtatcgttggacgtgattttcttccccgtggatcaggtgcattactgtcatcgttttcaccat |
40853331 |
T |
|
| Q |
130 |
tgtt |
133 |
Q |
| |
|
|||| |
|
|
| T |
40853332 |
tgtt |
40853335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 133 - 200
Target Start/End: Original strand, 40853385 - 40853452
Alignment:
| Q |
133 |
tcgaagactaacagataaatattaatttctcaagtaatcataggtgttagcgtgtctgtgtcatgtct |
200 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853385 |
tcgaagacgaacatataaatattaatttctcaagtaatcataggtgttagcgtgtctgtgtcatgtct |
40853452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 100
Target Start/End: Original strand, 11583766 - 11583830
Alignment:
| Q |
36 |
cagagttccggaaaatcgtcggtgttagagagtatcgttggacgtgattttcttccccgtggatc |
100 |
Q |
| |
|
|||||||| || |||||||| |||||||||||| | |||||| | |||||||| || |||||||| |
|
|
| T |
11583766 |
cagagttcagggaaatcgtcagtgttagagagtgttgttggaagggattttctaccacgtggatc |
11583830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University