View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_101 (Length: 256)
Name: NF1250_low_101
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 46565277 - 46565196
Alignment:
| Q |
8 |
tttgttaaccctttcttaattgttactcaattaccagattttt-cgttctttagtaactaccctgctcataattctcaattg |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46565277 |
tttgttaaccctttcttaattgttactcaattaccagattttttcgttctttagtaactaccctgctcataattctcaattg |
46565196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University