View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_102 (Length: 256)
Name: NF1250_low_102
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_102 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 34857018 - 34857251
Alignment:
| Q |
11 |
cacagaaggaagagaatctaacctgtgaatggccaccagcacaacactctcttgctataactaattttattaggctgcagagtccttctgtataaaaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857018 |
cacagaaggaagagaatctaacctgtgaatggccaccagcacaacactctcttgctataactaattttattaggctgcagagtccttctgtataaaaaat |
34857117 |
T |
 |
| Q |
111 |
aatgacattaataatgacaattatcgcgctaggcagagatcataggtaggctgcataacagttaccaactttaatagtcaagggatattcatattataga |
210 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34857118 |
a------------atgacaattatcacgctaggcagagatcataggtaggctgcataacagttacaaactttaatagtcaagggatattcatattataga |
34857205 |
T |
 |
| Q |
211 |
actgttagtgattactattgcatatattccacccccttctcctttt |
256 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857206 |
actgttagggattactattgcatatattccacccccttctcctttt |
34857251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University