View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_106 (Length: 252)
Name: NF1250_low_106
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 923631 - 923737
Alignment:
| Q |
1 |
atgtttttcttcttttaagatttccgattgaaaaatggtgnnnnnnnagatttctttaagagtttagatagaaaaatggtgtcttcttagagtttagaaa |
100 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
923631 |
atgtttttcttcttt-aagagtttggattgaaaaatggtgtctttttagatttctttaagagtttagatagaaaaatagtgtctttttagagtttagaaa |
923729 |
T |
|
| Q |
101 |
tgaatgca |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
923730 |
tgaatgca |
923737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 179 - 241
Target Start/End: Original strand, 22996457 - 22996517
Alignment:
| Q |
179 |
aataagttatttggatttattcattattaataacttacacatcaacagttagctctatttcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
22996457 |
aataagttatttggatttattcattattaataactt--acatcaatagatagctctatttcat |
22996517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 46833209 - 46833160
Alignment:
| Q |
59 |
agagtttagatagaaaaatggtgtcttcttagagtttagaaatgaatgca |
108 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
46833209 |
agagtttagataaaaaaatggtgtctttttagagtttaaaaatgaatgca |
46833160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 52 - 108
Target Start/End: Complemental strand, 27540938 - 27540883
Alignment:
| Q |
52 |
ttctttaagagtttagatagaaaaatggtgtcttcttagagtttagaaatgaatgca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| || ||| ||||||||||| |
|
|
| T |
27540938 |
ttctttaagagtttagatagaaaaatggtgtctt-ttatagcttataaatgaatgca |
27540883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 45032127 - 45032186
Alignment:
| Q |
52 |
ttctttaagagtttagatagaaaaatggtgtcttcttagagtttagaaatgaatgcaact |
111 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||||| | |||||||| ||||| |||||||| |
|
|
| T |
45032127 |
ttctttaagagtgtagatagtaaaattgtgtcttttaagagtttataaatgtatgcaact |
45032186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 52 - 113
Target Start/End: Original strand, 4357204 - 4357264
Alignment:
| Q |
52 |
ttctttaagagtttagatagaaaaatggtgtcttcttagagtttagaaatgaatgcaactga |
113 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| | ||||||| |||||||||||| |||| |
|
|
| T |
4357204 |
ttctttaagagtttagatataaaaaatgtgtctt-taagagtttggaaatgaatgcagctga |
4357264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University