View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_115 (Length: 229)
Name: NF1250_low_115
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_115 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 98 - 229
Target Start/End: Complemental strand, 3587171 - 3587040
Alignment:
| Q |
98 |
taatccagagtaaaaatccatatactcgtgcacaattcagcgagctcacgtacgaacttaattnnnnnnntgtatttaaactcttggcaaccgaatacag |
197 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
3587171 |
taatccagagtaaaaatccacatacccgtgcacaattcagcgagctcacgtacgaacttaattaaaaaaatgtatttaaacttttagcaaccgaatacag |
3587072 |
T |
 |
| Q |
198 |
gttctttataaggctaaggataagactgctaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3587071 |
gttctttataaggctaaggataagactgctaa |
3587040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University