View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1250_low_115 (Length: 229)

Name: NF1250_low_115
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1250_low_115
NF1250_low_115
[»] chr7 (1 HSPs)
chr7 (98-229)||(3587040-3587171)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 98 - 229
Target Start/End: Complemental strand, 3587171 - 3587040
Alignment:
98 taatccagagtaaaaatccatatactcgtgcacaattcagcgagctcacgtacgaacttaattnnnnnnntgtatttaaactcttggcaaccgaatacag 197  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||       |||||||||||| || ||||||||||||||    
3587171 taatccagagtaaaaatccacatacccgtgcacaattcagcgagctcacgtacgaacttaattaaaaaaatgtatttaaacttttagcaaccgaatacag 3587072  T
198 gttctttataaggctaaggataagactgctaa 229  Q
    ||||||||||||||||||||||||||||||||    
3587071 gttctttataaggctaaggataagactgctaa 3587040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University