View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_117 (Length: 227)
Name: NF1250_low_117
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_117 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 39307681 - 39307466
Alignment:
| Q |
12 |
ttgaacttatgtatgtattggactcatacctaaacttgtttacaaatcagcctctgttaattctgaatcccaatggcatcaaatttgaaaagtgaaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307681 |
ttgaacttatgtatgtattggactcatacctaaacttgtttacaaatcagcctctgttaattctgaatcccaatggcatcaaatttgaaaagtgaaaatg |
39307582 |
T |
|
| Q |
112 |
atttcaaaggacttattgacttcaaatccctgcacgaggaagcaaaggtgccacaagagtttatctggtcatccgaggatttggttgaaaccagcaaaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39307581 |
atttcaaaggacttattgacttcaaatccctgcacgaggaagcaaaggtgccacaagagtttatctggtcatccgaggatttggttgaaaccagcaaaga |
39307482 |
T |
|
| Q |
212 |
agagttgaatgtacct |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39307481 |
agagttgaatgtacct |
39307466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University