View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1250_low_119 (Length: 224)

Name: NF1250_low_119
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1250_low_119
NF1250_low_119
[»] chr3 (1 HSPs)
chr3 (1-135)||(55329538-55329678)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 55329538 - 55329678
Alignment:
1 ctttcagccgcattgcttatcccattcccgttaacccctctgttcaatttgtctatcttttctgtaatttgattaccaaaacactgcttctcgagaag-- 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
55329538 ctttcagccgcattgcttatcccattcccgttaacccctctgttcaatttgtctatcttttctgtaatttgattaccaaaacactgcttctcgagaagaa 55329637  T
99 ----aagaacaacaactctaatatcaaacttcttgatgatg 135  Q
        || ||||||||||||||||||||||||||||||||||    
55329638 caacaacaacaacaactctaatatcaaacttcttgatgatg 55329678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University