View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_139 (Length: 208)
Name: NF1250_low_139
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_139 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 114
Target Start/End: Complemental strand, 31381625 - 31381552
Alignment:
| Q |
41 |
atctaagtgaccttctagtgaaatcattttgttttttagttatttaatataaatatgaccaatttcatactttg |
114 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31381625 |
atctaagtgacattctagtgactacattttattttttagttatttaatataaatatgacctatttcgtactttg |
31381552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University