View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_140 (Length: 207)
Name: NF1250_low_140
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_140 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 2206100 - 2205975
Alignment:
| Q |
1 |
ttcgatggtatccccatggagatggttacatcatagttaatggtttctcttttggtaattcatgtaatgctggatttggaggtctcttgagaaataataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2206100 |
ttcgatggtatccccatggagatggttacatcatagttaatggtttctcttttggtaattcatgtaatgctgaatttggaggtctcttgagaaataataa |
2206001 |
T |
|
| Q |
101 |
tgacagttgaattcaagaattatcta |
126 |
Q |
| |
|
|||||||| ||||||||||| |||| |
|
|
| T |
2206000 |
tgacagttagattcaagaattttcta |
2205975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University