View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_42 (Length: 365)
Name: NF1250_low_42
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 11 - 339
Target Start/End: Complemental strand, 52472265 - 52471937
Alignment:
| Q |
11 |
catcagaaaggtcgtggtgaattggaaaaatatgttgagaagctctcagcataaaggaaaatagagacatatcaaaacataggcaacaatcgacgggtga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52472265 |
catcggaaaggtcgtggtgaattggaaaaatatgttgagaagctctaagcataaaggaaaatagagacatatcaaaacataggcaacaatcgacggatga |
52472166 |
T |
|
| Q |
111 |
gactgcctccttctataccttgctgaatggtgttactaagaaggatggggttttaaattggctaacaaaagaagggtgagtttctgtctaaacagcagca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472165 |
gactgcctccttctataccttgctgaatggtgttactaagaaggatggggttttaaattggctaacaaaagaagggtgagtttctgtctaaacagcagca |
52472066 |
T |
|
| Q |
211 |
agcagacatgacagttactatacggtgttaaaagagatcacaaaacacgtctcactgtaccaccacactcagcctatattctctcccaatgttgggcttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472065 |
agcagacatgacagttactatacggtgttaaaagagatcacaaaacacgtctcactgtaccaccacactcagcctatattctctcccaatgttgggcttc |
52471966 |
T |
|
| Q |
311 |
caagggcctcaatccaacacttggaccat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52471965 |
caagggcctcaatccaacacttggaccat |
52471937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University