View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_51 (Length: 342)
Name: NF1250_low_51
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 97 - 331
Target Start/End: Original strand, 46484823 - 46485058
Alignment:
| Q |
97 |
ccgatcatactcgactcata-tttaagagacggattaacaggccgggctagaatttttacaccaagtgatgtgttaagaaatagacagatggaggatcat |
195 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46484823 |
ccgatcatactcgactcaaaatttaagagacggattaacagtccgggctagaatttttacaccaagtgatgtgttaagaaatagacagatggaggatcat |
46484922 |
T |
|
| Q |
196 |
ccaatggacagagattggagttagttaataaattatgcacgacaatatttacatcattatattttaggttaggacaattttggatgcgacaatattgcaa |
295 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46484923 |
ccaatggacagaggttggagttagttaataaattatgcacgacaatatttacatcattatattttaggttaggacaattttggatgcgacaatattgcaa |
46485022 |
T |
|
| Q |
296 |
cttttgatggagatgtgctttcaagattttgttcat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46485023 |
cttttgatggagatgtgctttcaagattttgttcat |
46485058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University