View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_57 (Length: 317)
Name: NF1250_low_57
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 96 - 291
Target Start/End: Original strand, 33387662 - 33387857
Alignment:
| Q |
96 |
gtacgataaaagaagacatgcatccacggtttccttgattgtgtacactccatcaattgctagaaggaagtgaacctttgaagcaaaataagtagcaaca |
195 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387662 |
gtacgataaaagaagacatccatgcacggtttccttgattgtgtacactccatcaaatgctagaaggaagtgaacctttgaagcaaaataagtagcaaca |
33387761 |
T |
|
| Q |
196 |
tttatttgtgagtgacaacttttctagcttcatttttaccattattgcattgcaggtcttgatgctaatgccagatcttgtttcacatatattatt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387762 |
tttatttgtgagtgacaacttttctagcttcatttttaccattattgcattgcaggtcttgatgctaatgccagatcttgtttcacatatattatt |
33387857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University