View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_60 (Length: 314)
Name: NF1250_low_60
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 37 - 302
Target Start/End: Original strand, 41550942 - 41551207
Alignment:
| Q |
37 |
cataaagcactgcgtagcttgaaattcatcagcagtaaatccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacg |
136 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41550942 |
cataaagcactgcgtagtttgaaattcatcagcagtaaatccaacggtgttgatgcgtggaacgaagtgcagaagaattttgataagcttgcgaaagacg |
41551041 |
T |
 |
| Q |
137 |
gttttcttcatcgcgttgatttcggtcaatgcataggtcaatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551042 |
gttttcttcatcgcgttgatttcggtcaatgcataggtcaatttctttcttcaaatctcaatttatcataatcttgcaatgtttgttcaatgcatcttat |
41551141 |
T |
 |
| Q |
237 |
tcttannnnnnnnnnnngagtttctttaaatgcattttagtttggtgaatttatggcctaaatatt |
302 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551142 |
tcttattttttatttttgagtttctttaaatgcattttagtttggtgaatttatggcctaaatatt |
41551207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University