View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_64 (Length: 307)
Name: NF1250_low_64
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 59 - 228
Target Start/End: Complemental strand, 45127006 - 45126837
Alignment:
| Q |
59 |
aatataaactagattcaaagactaggtatttgtttgatatcaatgtgaatttctcgaaatcaaaatatagttgtaatacaaaacaagcactaaaagtagt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127006 |
aatataaactagattcaaagactaggtatttgtttgatatcaatgtgaatttctcgaaatcaaaatatagttgtaatacaaaacaagcactaaaagtagt |
45126907 |
T |
|
| Q |
159 |
tggtcccaggtgaacgcggagaatccacttccaaaatatctttctttcattttctgttggatgcattgct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45126906 |
tggtcccaggtgaacgcggagaatccacttccaaaatatctttctttcattttctgttggatgcattgct |
45126837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University