View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_71 (Length: 294)
Name: NF1250_low_71
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 114 - 283
Target Start/End: Complemental strand, 41704918 - 41704749
Alignment:
| Q |
114 |
taattgtttattgtttatgtacatgattcaatatnnnnnnnttagaggaacctgcatgtaacactagacataaatataaaatttgtcattttgtgcagaa |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704918 |
taattgtttattgtttatgtatatgattcaatataaaaaaaatagaggaacctgcatgtaacactagacataaatataaaatttgtcattttgtgcagaa |
41704819 |
T |
 |
| Q |
214 |
aataatggtttttagtacaggatatagaaaatgttgttaatagactatgcataacgtgtctgtcattcat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704818 |
aataatggtttttagtacaggatatagaaaatgttgttaatagactatgcataacgtgtctgtcattcat |
41704749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 24 - 116
Target Start/End: Complemental strand, 41705061 - 41704969
Alignment:
| Q |
24 |
atcttcaaaattcagtaaactgggaattgatcgccggttgcagttgcctgtccgttaggcatgaagttgaaagtgtttttggatttgaggtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41705061 |
atcttcaaaattcagtaaactgggaattgatcgccggttgcagttgcctgtccgttaggcatgaagttgaaagtgtttgtggatttgaggtaa |
41704969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University