View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_72 (Length: 293)
Name: NF1250_low_72
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_72 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 62 - 293
Target Start/End: Original strand, 9712292 - 9712523
Alignment:
| Q |
62 |
cgttgctcattagtgggttagtttgatatgtaacattgtagtaggatatcaagagtgtgaatgacgtagaaaaataagaaatggtatcgaacacctaacc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712292 |
cgttgctcattagtgggttagtttgatatgtaacattgtagtaggatatcaagagtgtgaatgacgtagaaaaataagaaatggtatcgaacacctaacc |
9712391 |
T |
 |
| Q |
162 |
gaccgtcttatttgtcagaatatcttacagaatcccatgcaatacggtgaatcttgtgtgtgcccacttctgtctcttcctctttctttatatattctgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712392 |
gaccgtcttatttgtcagaatatcttacagaatcccatgcaatacggtgaatcttgtgtgtgtccacttctgtctcttcctctttctttatatattctgt |
9712491 |
T |
 |
| Q |
262 |
tcttttcaacattagttagttgcactcgtgtt |
293 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
9712492 |
ttctttcaacattagttagttgcactcgtgtt |
9712523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University