View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_73 (Length: 289)
Name: NF1250_low_73
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_73 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 76 - 289
Target Start/End: Original strand, 2617456 - 2617671
Alignment:
| Q |
76 |
aataataacttacatcatggtagtacggaatagaaatgagtaannnnnnnnnnnnnnnnncctcaagcaaaagttatttacttttattaagcaaaagtaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
2617456 |
aataataacttacatcatggtagtacggaatagaaatgagtaatttttttcttcttttttcctcaagcaaaagttacttacttttattaagaaaaagtaa |
2617555 |
T |
|
| Q |
176 |
cattgccaaagtaaaataagt--tttcgtctgaaattagagttttaagaggaaaactgctaagtataatttgttctttatacatttatataaaagttacc |
273 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2617556 |
cattgccaaagtaaaataagtgttttcgtctgaaattagagttttaagaggaaaactgctaagtataatttgttctttatacatttatataaaagttacc |
2617655 |
T |
|
| Q |
274 |
gagtatttctagttac |
289 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2617656 |
gagtatttctagttac |
2617671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University