View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_75 (Length: 286)
Name: NF1250_low_75
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_75 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 9684055 - 9683945
Alignment:
| Q |
18 |
cttttagtgcaccatagatatgttgcaatttgaaaaaggtttgttaatggttttgtgcttttaaggactctttgtgactcgagcactgatgatgtcgaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9684055 |
cttttagtgcaccatagatatgttgcaatttgaaaaaggtttgttaatggttttgtacttttaaggactctttgtgactcgagcactgatgatgtcgaag |
9683956 |
T |
 |
| Q |
118 |
aagcatacttc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
9683955 |
aagcatacttc |
9683945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University