View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_90 (Length: 267)
Name: NF1250_low_90
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_90 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 30 - 149
Target Start/End: Complemental strand, 40184745 - 40184627
Alignment:
| Q |
30 |
agttttcccagggccagatccagtggtaagaatactagggaccttatgattttacaaacttaga-atggagacttggcatgacacacacgaacacttcaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| || ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184745 |
agttttcccagggccagatccagtggtaagaataccagggatct-atgattt-acaaacttagacatggagacttggcatgacacacacgaacacttcaa |
40184648 |
T |
|
| Q |
129 |
aatatacatgtgtatctaaat |
149 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40184647 |
aatatacatgtgtatctaaat |
40184627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 40184627 - 40184574
Alignment:
| Q |
202 |
tacattcacctatctactatgaaagtttaaaattatgtaatcaaatttaatatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40184627 |
tacattcacctatctactatgaaagtttaaaatgatgtaatcaaatttaatatt |
40184574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University