View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_91 (Length: 266)
Name: NF1250_low_91
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 4081294 - 4081531
Alignment:
| Q |
1 |
tttcaaatataaaattactaactttgattactttaattagtgtcctaagggtacttgttaatgacac-cttacaattaaataaaagtcaaatggtcgtat |
99 |
Q |
| |
|
|||| ||| ||||||| |||| ||| ||||||| || ||||||| |||||| ||||||||| || || ||| ||||||||| | |||||||||||| ||| |
|
|
| T |
4081294 |
tttccaatgtaaaattgctaattttaattacttaaactagtgtcttaagggcacttgttaacgagactcttccaattaaatgagagtcaaatggtcctat |
4081393 |
T |
|
| Q |
100 |
gaattagacatgacaaaataaaattcttgaattgtcacattattcagctcatatcctaaatatcaatgtccaactaatgttgatcccgaacattcttaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4081394 |
caattagacatgacaaaataaaattcttgaattgtcacattaatcagctcatatcctaaatatcaatgtccaactaatgttgatcccgaacattcttaat |
4081493 |
T |
|
| Q |
200 |
ccaagttttgcaagttgcatgtgatctagtatagacta |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4081494 |
ccaagttttgcaagttgcatgtgatctagtatagacta |
4081531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University