View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_92 (Length: 265)
Name: NF1250_low_92
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 2510130 - 2510011
Alignment:
| Q |
8 |
cttccattttctctcaattctctctgtttttctctctagctacattatgtgtgaatgtataaaatgaataattcaaccctaatctcatattggatctagt |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510130 |
cttccattttctctcaattctctctatttttctctctagctacattatgtgtgaatgtataaaatgaataattcaaccctaatctcatattggatctagt |
2510031 |
T |
|
| Q |
108 |
gtcttttactacttaattaa |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2510030 |
gtcttttactacttaattaa |
2510011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 194 - 257
Target Start/End: Complemental strand, 2509944 - 2509881
Alignment:
| Q |
194 |
tctttgataaggaacataggggttttttagtgaggcttcggtggtgaaagttttgttgcctttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
2509944 |
tctttgataaggaacataggggttttttagtgaggcttaggtggtgacagttttgttgcctttg |
2509881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 19801589 - 19801662
Alignment:
| Q |
17 |
tctctcaattctctctgtttttctctctagctacattatgtgtgaatgtataaaatgaataattcaaccctaat |
90 |
Q |
| |
|
|||||||||||||||| | ||||||||||| || |||||||||||| ||| ||||||| | |||||||||||| |
|
|
| T |
19801589 |
tctctcaattctctctaatattctctctagccaccttatgtgtgaatatatgaaatgaaaagttcaaccctaat |
19801662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University