View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_93 (Length: 265)
Name: NF1250_low_93
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 30609135 - 30608900
Alignment:
| Q |
1 |
tgaagccttatgaatactttattccatgtttagttttaattcaactagcaaaaatgttgatattgttagactgaagatcgtaatcggagttcgaacttcg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30609135 |
tgaagccttatgaatactttattgcatgattagctttagttcaactagcaaaaatgttgatattgttagactgaagatcgtaatcggagttcgaatttcg |
30609036 |
T |
|
| Q |
101 |
acccctccacttatatatgtaagttttaatcaatttgtttat-nnnnnnnnnnnnnnnnnctttattacacttgtgcttgttatacacacatatgatttt |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30609035 |
acccctccacttatgtatgtaagttttaatcaatttgtttataaaaaaaaaaaaaaaaaactttattacacttgtgcttgttatacacacatatgatttt |
30608936 |
T |
|
| Q |
200 |
gctttgtgaaacggttttgaaaaatctttattatgca |
236 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30608935 |
gc-ttgtgaaacggttttgaaaaatctttattatgca |
30608900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University