View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1250_low_98 (Length: 258)
Name: NF1250_low_98
Description: NF1250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1250_low_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 41942631 - 41942817
Alignment:
| Q |
37 |
atattgatgacaatgtatgaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942631 |
atattgatgacaatgtatgaaggttgagagaaataaataaattgaaataacataaggtcagagcttgtttgaaatgtcatttcaaagtacaacacattat |
41942730 |
T |
 |
| Q |
137 |
tattcagagtatatgaatatgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942731 |
tattcagagtatatgaatatgaattgtgtctatttttccctgatcagcccaaccaacaaaaacgggactccacgttctctgtctcca |
41942817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University