View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12510_low_2 (Length: 250)

Name: NF12510_low_2
Description: NF12510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12510_low_2
NF12510_low_2
[»] chr5 (2 HSPs)
chr5 (141-240)||(38121272-38121371)
chr5 (1-50)||(38121133-38121182)


Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 38121272 - 38121371
Alignment:
141 gtcctaaactgagttttatttcacaatgtgaaccttatttgctttaatttgtgctttaattactctttacgtctcccataagctctgatttagccctatg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38121272 gtcctaaactgagttttatttcacaatgtgaaccttatttgctttaatttgtgctttaattactctttacgtctcccataagctctgatttagccctatg 38121371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 38121133 - 38121182
Alignment:
1 tttttatcttaactttgcatgtttttattttgtaatgtggtaaacacaag 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
38121133 tttttatcttaactttgcatgtttttattttgtaatgtggtaaacacaag 38121182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University