View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12510_low_2 (Length: 250)
Name: NF12510_low_2
Description: NF12510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12510_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 38121272 - 38121371
Alignment:
| Q |
141 |
gtcctaaactgagttttatttcacaatgtgaaccttatttgctttaatttgtgctttaattactctttacgtctcccataagctctgatttagccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38121272 |
gtcctaaactgagttttatttcacaatgtgaaccttatttgctttaatttgtgctttaattactctttacgtctcccataagctctgatttagccctatg |
38121371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 38121133 - 38121182
Alignment:
| Q |
1 |
tttttatcttaactttgcatgtttttattttgtaatgtggtaaacacaag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38121133 |
tttttatcttaactttgcatgtttttattttgtaatgtggtaaacacaag |
38121182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University