View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_high_13 (Length: 306)
Name: NF12511_high_13
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 40105556 - 40105278
Alignment:
| Q |
18 |
aaaactcgattcaatcaaatcaacaagacgtaatagactttttccttacagagataacgaggagagcgcggaggggacttccacggcgagtccatacgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40105556 |
aaaactcgattcaatcaaatcaacaagacgtaatagactttttccttacagagataacgaggagagcgcggaggggacttccacggcgagtccatacgag |
40105457 |
T |
|
| Q |
118 |
aacatcgttggcggagtttctagaagcttctggaatgagaggagcgttatccgcgacagagtttttgatccggcgaagtaaggaagttccgtcgtccggg |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40105456 |
aacatcgttggcagagtttctagaagcttctggaatgagaggagcgttatccgcgacagagtttttgatccggcgaagtaaggaagttccgtcggccggg |
40105357 |
T |
|
| Q |
218 |
tccgggaaaaggatggtggatgcgagacggttgaggacctccggtaaagtttgttttaccggtttagtatttctgtgct |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40105356 |
tccgggaaaaggatggtggatgcgagacggttgaggacctccggtaaagtttgttttaccggtttagtatttctgtgct |
40105278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University