View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_high_25 (Length: 232)
Name: NF12511_high_25
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 76 - 216
Target Start/End: Complemental strand, 36024927 - 36024787
Alignment:
| Q |
76 |
ataactggtagacttgaaagtaagaatgcatgcaagcaataattaccacccttcataaaacatttgaagtgattatcaatcgggttgcgtatatacatta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36024927 |
ataactggtagacttgaaagtaagaatgcatgcaagcaataattaccacccttcataaaacatttgaagtgattataaatcgggttgcgtatatacatta |
36024828 |
T |
 |
| Q |
176 |
atacgagtaacaatggaagatccggtcaaaataatatctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36024827 |
atacgagtaacaatggaagatccggtcaaaataatatctct |
36024787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University