View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_high_6 (Length: 360)
Name: NF12511_high_6
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 20 - 351
Target Start/End: Complemental strand, 31200393 - 31200057
Alignment:
| Q |
20 |
cagagcacaaccttaaatttagagctctcttactctaatttctagaagctacaaaatgtagcctgtgccatgtggtccatcgtaatcgagataaataaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31200393 |
cagagcacaaccttaaatttagagctctcttactctaatttctagaagctacaaaatgtagcctgtgccatgtggtccatcataatcgagataaataaag |
31200294 |
T |
|
| Q |
120 |
atttagtttat---atgcaccgaaaatgtaannnnnnnnnngttgtttaaacacacgtacaatcaaatcactttata---ccgtttttataggatggagt |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31200293 |
atttagtttattatatgcaccgaaaatgtaatatttttttt-ttgtttaaacacgcgtacaatcaaatcactttatagtgccgtttttataggatggagt |
31200195 |
T |
|
| Q |
214 |
tgctagttgtactccatgcttgattaagcttcagtcttttcttatagttgtatttcgaccattttgttatccataaaagaaagttaaactcaaaagtttc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31200194 |
tgctagttgtactccatgcttgattaagcttcagtcttttcttatagttgtatttcgaccattttgttatccataaaagaaagttaaactcaaaagtttc |
31200095 |
T |
|
| Q |
314 |
atttctctcatcataatggaatcattttcatctctctc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31200094 |
atttctctcatcataatggaatcattttcatttctctc |
31200057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University