View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_high_9 (Length: 335)
Name: NF12511_high_9
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 7197909 - 7197587
Alignment:
| Q |
1 |
gtgctgacatggctacttcttcctgtgctgacatggctgtttctgcttgaagaatcatagcttagtacatcatcttttgtttcagcaccaagaactttct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197909 |
gtgctgacatggctacttcttccagtgctgacatggctgtttctgcttgaagaatcatagcttagtacatcatcttttgtttcagcaccaagaactttct |
7197810 |
T |
 |
| Q |
101 |
ctaactcatcattgatgagtttgagatcattttcagttacttcgtcttcgttttcattttcggttatggtttgaactgagattggaaatgatggtgttga |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197809 |
ctaactcatcatttatgagtttgagatcattttcagttacttcgtcttcgttttcattttcggttatggtttgaactgagattggaaatgatggtgttga |
7197710 |
T |
 |
| Q |
201 |
tggatttgatgaaattggttggtctgatccaagtgttccaattgcaaggaagccagggaagagatcaaacatagcatcatcatcttgtgattgtctgcca |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197709 |
tagatttgatgaaattggttggtctgatccaagtgttccaattgcaaggaagccagggaagagatcaaacatagcatcatcatcttgtgattgtctgcca |
7197610 |
T |
 |
| Q |
301 |
tattcttcttcatgttcttctct |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7197609 |
tattcttcttcatgttcttctct |
7197587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 7197932 - 7197896
Alignment:
| Q |
2 |
tgctgacatggctacttcttcctgtgctgacatggct |
38 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7197932 |
tgctgacatggctacttcttccagtgctgacatggct |
7197896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University