View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_low_18 (Length: 308)
Name: NF12511_low_18
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 46379339 - 46379075
Alignment:
| Q |
19 |
aacctagcttcgtgagttatcataggttaaataattacagatagggaagaatctcaccgtacctaaattttgatgaagaatctcccccacttggtattc- |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379339 |
aacctagcttcgtgagttatcataggttaaataattacaaatagggaagaatctcaccgtacctaaattttgatgaagaatctcccccacttggtattta |
46379240 |
T |
 |
| Q |
118 |
gtcggaaaactacccttaattttctatgaaggtttaaagaatgtgagagtaagaaacggtcaaggtaaagtaagcgagacaaagatatatacgagattga |
217 |
Q |
| |
|
|||| |||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379239 |
gtcg--aaacta-----aattttg-atgaag--------aatgtgagagtaagaaacggtcaaggtaaagtaagcgagacaaagatatatacgagattga |
46379156 |
T |
 |
| Q |
218 |
agaagttgtgccttctactgccggtattgtaatgttgtagttttttgaatcattgtttgttacaacgcctctatgcctatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46379155 |
agaagttgtgccttctactgccggtattgtaatgttgtagttttttgaatcattgtttgttacaacgcctctatgcctatg |
46379075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University