View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_low_27 (Length: 269)
Name: NF12511_low_27
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 27 - 254
Target Start/End: Complemental strand, 4417592 - 4417365
Alignment:
| Q |
27 |
agttcaatctgatgcaaaaaattactgataattactttgtgcaaaatgtaaaatatatgttgaaataaacaattagtctctacatttttgccagattttt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417592 |
agttcaatctgatgcaaaaaattactgataattactttgtgcaaaatgtaaaatatatgttgaaataaacaattagtctctacatttttgccagattttt |
4417493 |
T |
 |
| Q |
127 |
attttgattcctttagtttgtcttgagtagaaaccacaagatgatcaatgttgtggaaaataaattctacatgaaggtatatcatatttagatcactatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417492 |
attttgattcctttagtttgtcttgagtagaaaccacaagatgatcaatgttgaggaaaataaattctacatgaaggtatatcatatttagatcactatg |
4417393 |
T |
 |
| Q |
227 |
cttacccatgagcatgatcgatgcagtg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4417392 |
cttacccatgagcatgatcgatgcagtg |
4417365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University