View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_low_37 (Length: 221)
Name: NF12511_low_37
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 21 - 213
Target Start/End: Original strand, 32133481 - 32133672
Alignment:
| Q |
21 |
atcaaaatgataatgcaagatgacaatgcattaagataaaaaatgacgaatttcattgtcaagtaggagtattgtatttttcaagagattgttgcaaccc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32133481 |
atcaaaatgataatgcaagatgacaatgcattaagataaaaaatgacgaatttcattgtcaagtaggagtattgtatttttcaagagattgttgcaaccc |
32133580 |
T |
|
| Q |
121 |
tacattaccctataaccaaacaattaacaatcttcnnnnnnnnnnnnttaagcttaaagcaagtatcagaaagagaggaacagtgaacgagca |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32133581 |
tgcattaccctataaccaaacaattaacaatcttc-aaaaaaaaaaattaagcttaaagcaagtatcagaaagagaggaacagtaaactagca |
32133672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 53
Target Start/End: Complemental strand, 29389715 - 29389683
Alignment:
| Q |
21 |
atcaaaatgataatgcaagatgacaatgcatta |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
29389715 |
atcaaaatcataatgcaagatgacaatgcatta |
29389683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 53
Target Start/End: Complemental strand, 21187751 - 21187719
Alignment:
| Q |
21 |
atcaaaatgataatgcaagatgacaatgcatta |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
21187751 |
atcaaaatcataatgcaagatgacaatgcatta |
21187719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University