View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_low_38 (Length: 221)
Name: NF12511_low_38
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 14975988 - 14976205
Alignment:
| Q |
1 |
aggtaagcaaaactcccaccaaaccccacctcacaacttttatttttcttctcatctcacattccattccccacacactttgannnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
14975988 |
aggtaagcaaaactcccaccaaaccccacctcacaacttttatttttcttctcatctaacattc-----cccacacactttgactctctctctctctctc |
14976082 |
T |
 |
| Q |
101 |
nnn--aggtttctctagaaatacacgcaactcttttccttttttggggcttcaaattttgacaccaaagtttcacacaaagattgtgccttttcttgttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14976083 |
tctctaggtttctctagaaatacacgcaactcttttccttttttggggcttcaaattttgacaccaaagtttcacacaaagattgtgccttttcttgttt |
14976182 |
T |
 |
| Q |
199 |
gcttctaagtacttgtacttttt |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14976183 |
gcttctaagtacttgtacttttt |
14976205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University