View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12511_low_39 (Length: 215)
Name: NF12511_low_39
Description: NF12511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12511_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 6 - 200
Target Start/End: Complemental strand, 28519851 - 28519649
Alignment:
| Q |
6 |
tagtggagaagcagagattgtgggcaaatcttgtgttgattaaaaacacttttggtgatggtgt-------atggttggggatttcaatgcggtgagcca |
98 |
Q |
| |
|
|||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28519851 |
tagtggcgaaacaaagattgtgggcaaatcttgtgttgattaaaaacacttttggtgatggtgtgtggtgtatggttggggatttcaatgcggtgagcca |
28519752 |
T |
|
| Q |
99 |
tgcagatgaaaggagggggg-tcaattcggttgtttcatcggcacaatctttggaaacatatttcttcaattcttttgttttgaatgttgatttatttga |
197 |
Q |
| |
|
||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519751 |
tgcggatgaaagaagggggggtcaattcggttgtttcatcggcacaatctttggaaacatatttcttcaattcttttgttttgaatgttgatttatttga |
28519652 |
T |
|
| Q |
198 |
tgt |
200 |
Q |
| |
|
||| |
|
|
| T |
28519651 |
tgt |
28519649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University