View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12512_high_5 (Length: 210)
Name: NF12512_high_5
Description: NF12512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12512_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 33 - 197
Target Start/End: Original strand, 37280496 - 37280660
Alignment:
| Q |
33 |
gaccccaacaatagttaactaccgctggcccaaatggtagttaactaccgctcatttcatcaaaattttacaaagtttgaggcatacacacccattactt |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37280496 |
gaccccgacaatagttaactaccgctggcccaaacggtagttaactaccgctcatttcatcaaaattttacaaagtttgaggcatacacacccattactt |
37280595 |
T |
 |
| Q |
133 |
ttatcttgcgtgtctctcttcaattgatattttcagttatttatctcttgtttttcttctctgct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37280596 |
ttatcttgcgtgtctctcttcaattgatattttcagttatttatctcttgtttttcttctctgct |
37280660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 33 - 197
Target Start/End: Complemental strand, 5124454 - 5124290
Alignment:
| Q |
33 |
gaccccaacaatagttaactaccgctggcccaaatggtagttaactaccgctcatttcatcaaaattttacaaagtttgaggcatacacacccattactt |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5124454 |
gaccccgacaatagttaactaccgctggcccaaacgatagttaactaccacttatttcatcaaaattttacaaagtttgaggcatacacacccattacat |
5124355 |
T |
 |
| Q |
133 |
ttatcttgcgtgtctctcttcaattgatattttcagttatttatctcttgtttttcttctctgct |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5124354 |
ttatcttgcgtgtttctcttcaattgatattttcagttatttatctcttgtttttcttctttgct |
5124290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 28757770 - 28757649
Alignment:
| Q |
68 |
ggtagttaactaccgctcatttcatcaaaattttacaaagtttgaggcatacacacccattacttttatcttgcgtgtctctcttcaattgatattttca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| | |||||||||||||| | |||||||| |||||| | |
|
|
| T |
28757770 |
ggtagttaactaccgctcatttcatcaaaagtttataaagtttgaggcatacacacgcattacatctatcttgcgtgtctttgttcaattggtattttta |
28757671 |
T |
 |
| Q |
168 |
gttatttatctcttgtttttct |
189 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28757670 |
attatttatctcttgtttttct |
28757649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 84
Target Start/End: Complemental strand, 32473132 - 32473088
Alignment:
| Q |
40 |
acaatagttaactaccgctggcccaaatggtagttaactaccgct |
84 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
32473132 |
acaacagttaactaccgctggccccagtggtagttaactaccgct |
32473088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University