View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_high_14 (Length: 337)
Name: NF12513_high_14
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 17 - 323
Target Start/End: Original strand, 29838274 - 29838580
Alignment:
| Q |
17 |
agaagaatgctgatcaatttgttccggttacttttgtgcgctctttacaggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838274 |
agaagaatgctgatcaatttgttccggttacttttgtgcgctctttacaggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcattt |
29838373 |
T |
 |
| Q |
117 |
gatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaagatcatccagtgacggtcatcagcagagagtatcagatggtatgtaccaagta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838374 |
gatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaagatcatccagtgacggtcatcagcagagagtatcagatggtatgtaccaagta |
29838473 |
T |
 |
| Q |
217 |
atactacaaaatgattggtaaatgcttgcaaatcgtgtataaatggtgacaaccgcgtaataacttgacattatcaaatgatcttgtttcttctgtgtgc |
316 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838474 |
atactacaaaaagattggtaaatgcttgcaaatcgcgtataaatggtgacaaccgcgtaataacttgacattatcaaatgatcttgtttcttctgtgtgc |
29838573 |
T |
 |
| Q |
317 |
ttctgtg |
323 |
Q |
| |
|
||||||| |
|
|
| T |
29838574 |
ttctgtg |
29838580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 64 - 205
Target Start/End: Complemental strand, 34628284 - 34628143
Alignment:
| Q |
64 |
caggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaa |
163 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| || ||||| |||||| ||| ||||| || ||| |||||||||| | || ||||||| |
|
|
| T |
34628284 |
caggaaacagccatgtctaatgcttggtatgaagtgttgtcagtcttgcacttgatggcaacactattgctatcacaggctaatttattacttcttccaa |
34628185 |
T |
 |
| Q |
164 |
gatcatccagtgacggtcatcagcagagagtatcagatggta |
205 |
Q |
| |
|
|| |||||| || |||||||||| | ||||||||| |||| |
|
|
| T |
34628184 |
gaacatccaccgatggtcatcagccaaaagtatcagaaggta |
34628143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University