View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_high_27 (Length: 205)
Name: NF12513_high_27
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 11573776 - 11573945
Alignment:
| Q |
21 |
gaagaagcataagattgaagattccctcttgtttatattatgaattgtgttggaatccaaggaactgttttattagctagccgtgatttcataggagggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11573776 |
gaagaagcataagattgaagattccctcttgtttatattatgaattgtgttggaatccaaggaactgttttattagctagacgtgatttcataggagggg |
11573875 |
T |
|
| Q |
121 |
agctgctgctggcgaatttgtttggccactgttggcgcatcggttttctgttgtagcagttgcgtctgtg |
190 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
11573876 |
agctgctgctgtcgaatttgtttgactgctgttggtgcatcggttttctgttgaagcagctgcgtctgtg |
11573945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University