View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_high_6 (Length: 498)
Name: NF12513_high_6
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_high_6 |
 |  |
|
| [»] scaffold0366 (3 HSPs) |
 |  |  |
|
| [»] scaffold0459 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0366 (Bit Score: 162; Significance: 3e-86; HSPs: 3)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 241 - 402
Target Start/End: Complemental strand, 8889 - 8728
Alignment:
| Q |
241 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatacggccacagttgccgttg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8889 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatacggccacagttgccgttg |
8790 |
T |
 |
| Q |
341 |
tagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8789 |
tagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
8728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 9120 - 8959
Alignment:
| Q |
18 |
cttacactttttgtgatgactctctatttatgtatgtatgaatgcagatatgaagagctttaaaacacctttcaagggtattgtagatgattttagggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9120 |
cttacactttttgtgatgactctctatttatgtatgtatgaatgcagatatgaagagctttaaaacacctttcaagggtattgtagatgattttagggga |
9021 |
T |
 |
| Q |
118 |
agagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagcttc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9020 |
agagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagcttc |
8959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 8677 - 8640
Alignment:
| Q |
453 |
acaggatattggcaccgactatgtatattttctctgct |
490 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8677 |
acaggatattggcaccgactatgtatattttctttgct |
8640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 158; Significance: 7e-84; HSPs: 3)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 158; E-Value: 7e-84
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 9196 - 9035
Alignment:
| Q |
18 |
cttacactttttgtgatgactctctatttatgtatgtatgaatgcagatatgaagagctttaaaacacctttcaagggtattgtagatgattttagggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9196 |
cttacactttttgtgatgactctctatttatgtatgtatgaatgcagatatgaagagctttaaaacacctttcaagggtattgtagatgattttacggga |
9097 |
T |
 |
| Q |
118 |
agagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagcttc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9096 |
agagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagcttc |
9035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 241 - 402
Target Start/End: Complemental strand, 8965 - 8804
Alignment:
| Q |
241 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatacggccacagttgccgttg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatacggccacagttgccgttg |
8866 |
T |
 |
| Q |
341 |
tagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
402 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8865 |
tagagacatttaaaacctctacactgtcgccacaatgcaattgcagaccgtgatttagaact |
8804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 453 - 490
Target Start/End: Complemental strand, 8753 - 8716
Alignment:
| Q |
453 |
acaggatattggcaccgactatgtatattttctctgct |
490 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8753 |
acaggatattggcaccgactatgtatattttctttgct |
8716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 103; Significance: 5e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 50 - 179
Target Start/End: Complemental strand, 12319311 - 12319181
Alignment:
| Q |
50 |
tatgtatgaatgcagatatgaagagctttaaaaca-cctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggattt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12319311 |
tatgtatgaatgcagatatgaagagctttaaaaaaacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggattt |
12319212 |
T |
 |
| Q |
149 |
ctggtctcacttctggaaccgggtaagcttc |
179 |
Q |
| |
|
| |||||| | || ||||||||||||||||| |
|
|
| T |
12319211 |
caggtctcgcctcaggaaccgggtaagcttc |
12319181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University