View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_low_24 (Length: 267)
Name: NF12513_low_24
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 43052569 - 43052810
Alignment:
| Q |
16 |
taaacaattggctagccgagacatggtcgatcgaccgatatacctgtactttccaattcctttccatagaagtgcttgttgaggaaataggaatgagatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43052569 |
taaacaattggctagccgagacatggtcgatcgaccgatatacctgtactttccaattcctttccatagaagtgcttgttgaggaaataggaatgagatt |
43052668 |
T |
|
| Q |
116 |
ttctaaggtgtttgcagggactagaagagacgaatcacattgctttgtccatctttgttcaaaattggttaaaacatcccaagccgcctcgccagtaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43052669 |
ttctaaggtgtttgcagggactagaagagacgaatcacattgctttgtccatctttgttcaaaattggttaaaacatcccaagccgcctcgccagtaaca |
43052768 |
T |
|
| Q |
216 |
caagcatgagcatcatgccaaggctctcttggacctcctttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43052769 |
caagcatgagcatcatgccaaggctctcttggacctcctttg |
43052810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 104 - 257
Target Start/End: Complemental strand, 5401184 - 5401031
Alignment:
| Q |
104 |
aggaatgagattttctaaggtgtttgcagggactagaagagacgaatcacattgctttgtccatctttgttcaaaattggttaaaacatcccaagccgcc |
203 |
Q |
| |
|
|||||||||||| | |||||| | | |||||||||||| || | ||| |||||||||||||||||||| |||||||| ||||| ||||||||||| ||| |
|
|
| T |
5401184 |
aggaatgagattaaccaaggtgctcgtagggactagaagcgaaggatcgcattgctttgtccatctttgctcaaaatttgttaacacatcccaagcagcc |
5401085 |
T |
|
| Q |
204 |
tcgccagtaacacaagcatgagcatcatgccaaggctctcttggacctcctttg |
257 |
Q |
| |
|
|| ||| ||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
5401084 |
tcaccaataacacaagcatgagcatcatgccaaggcactcttggtcctcctttg |
5401031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University