View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_low_25 (Length: 257)
Name: NF12513_low_25
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 41319972 - 41320202
Alignment:
| Q |
19 |
acgaagacggtatcatcgtcacccatgacgaaccaccgtacatctttcattccgagccggagtgtttccgagacgattcgtgagattcggattgcggaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41319972 |
acgaagacggtatcatcgtcacccatgacgaaccaccgtacatctttcattccgagccggagtgtttccgatacgattcgtgagattcggattgcggaac |
41320071 |
T |
 |
| Q |
119 |
ggtgaccttgtttgtttttataagcgaattttgaagtgtcgccggagattctcaccggcgggagccgactttcgttcttttgggttttaaccttgttgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320072 |
ggtgaccttgtttgtttttataagcgaattttgaagtgtcgccggagattctcaccggcgggagccgactttcgttcttttgggttttaaccttgttgtc |
41320171 |
T |
 |
| Q |
219 |
tagccatactacaccacgcatttcctttgct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41320172 |
tagccatactacaccacgcatttcctttgct |
41320202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University