View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12513_low_27 (Length: 252)
Name: NF12513_low_27
Description: NF12513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12513_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 33711567 - 33711347
Alignment:
| Q |
20 |
aaaaaatactatataaattgtatagctttcagaatatgatagaaaaatgaattgagagaagaatgaagttttggtcaatggcttgtaaagcaaagaaagt |
119 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711567 |
aaaaaatactatataa-ttgcatagctttcagaatatgatagaaaaatgaattgagagaagaatgaagttttggtcaatggcttgtaaagcaaagaaagt |
33711469 |
T |
|
| Q |
120 |
gtgatgtgaaatgtgacatttattcaatcatacatatttgaagcttctgagagtcttggaaattgagatatttttccaactggttttgcctctttggtag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33711468 |
gtgatgtgaaatgtgacatttattcaatcatacatatttgaagcttctgagagtcttggaaattgagatatttttccaactggttttgcctctttggtag |
33711369 |
T |
|
| Q |
220 |
ggagcaagaaagtgaacgagca |
241 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
33711368 |
ggagcaagaaagtgaaagagca |
33711347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University