View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12514_low_3 (Length: 340)
Name: NF12514_low_3
Description: NF12514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12514_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 192 - 301
Target Start/End: Complemental strand, 9876768 - 9876659
Alignment:
| Q |
192 |
aggcttctgctactgtttttagtgtttgtggatttacaaaggtatttttggatttatgattttgctagggtttgatgttataatgatatgtaattgaatt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9876768 |
aggcttctgctactgtttttagtgtttgtggatttacaaaggtatttttggatttatgattttgctagggtttgatgttataatgatatgtaattgaatt |
9876669 |
T |
|
| Q |
292 |
tgttgaccta |
301 |
Q |
| |
|
|||||||||| |
|
|
| T |
9876668 |
tgttgaccta |
9876659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 9876941 - 9876885
Alignment:
| Q |
19 |
agtgtttggtgtatgaactgaaaatgattttgattttgttgttgactctagaggtgg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9876941 |
agtgtttggtgtatgaactgaaaatgattttgattttgttgttgactctagaggtgg |
9876885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University