View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12514_low_6 (Length: 239)
Name: NF12514_low_6
Description: NF12514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12514_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 40998696 - 40998476
Alignment:
| Q |
19 |
gtcattgagataaatttctcatctctagatgtgatttccagatttcaatcattattatacccaaacagagcgtaagtagtggagccaattatataatctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998696 |
gtcattgagataaatttctcatctctagatgtgatttccagatttcaatcattattatacccaaacagagcgtaagtagtggagccaattatataatctt |
40998597 |
T |
|
| Q |
119 |
ttgtgtaaattgatctgtctactcaaactatatttgctagatgcccaaaccaccaataggggtgtgttgtgtataattataaaaaggttaaaatgtgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40998596 |
ttgtgtaaattgatctgtctactcaaactatatttgctagatgcccaaaccaccaataggggtgcgttctgtataattataaaaaggttaaaatgtgttt |
40998497 |
T |
|
| Q |
219 |
ttcgtccatacaaatatgatg |
239 |
Q |
| |
|
|| |||| ||||||||||||| |
|
|
| T |
40998496 |
ttggtccttacaaatatgatg |
40998476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University