View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_18 (Length: 332)
Name: NF12515_high_18
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 310
Target Start/End: Original strand, 45701838 - 45702120
Alignment:
| Q |
19 |
atctctactaatcacatttcgtctcacgtactcaattcatccaaccgtccttccatgttaaaaaatgggtccattgatgaacactcattttctcgttttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45701838 |
atctctactaatcacatttcgtctcacgtactcaattcatccaaccgtccttccatgttaaaaaatgggtccatctatgaacactcattttctcgttttt |
45701937 |
T |
 |
| Q |
119 |
taattg-----cattgcatggactaataatcaagcgaatgtcacccacatgttatgatggatcgtgtgccagatggtttctttagtgaataaggacttaa |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701938 |
taattgcattgcattgcatggactaataatcaagcgaatgtcacccacatgttatgctggatcgtgtgccagatggtttctttagtgaataaggacttaa |
45702037 |
T |
 |
| Q |
214 |
tttgatcctattattgtctattcaatttagtctctaaattattattctttcagttnnnnnnnntagtgataatttaaagaacaaattaactatttat |
310 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
45702038 |
tttgatcctattatt--------------gtctctaaattattattctttcagttaaaaaaaatattgataatttaaagaacaaattaactatttat |
45702120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University