View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_23 (Length: 301)
Name: NF12515_high_23
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 150 - 290
Target Start/End: Complemental strand, 30992195 - 30992056
Alignment:
| Q |
150 |
tcgtctagcagacgggtagcacatgaagatggaccgttggatttggatgactcgaatgttggtgtccatgttgaaaatgatgcctgataagtgtttgtac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30992195 |
tcgtctagcagacgggtagcacatgaagatggaccgttggacttggatgactcgaatgttggtgtccatgttgaaaatgatgcctaataagtgtttgtac |
30992096 |
T |
|
| Q |
250 |
tagatctttcactttaataatatttctacctagtgagtatc |
290 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30992095 |
tagatctttcactttaataata-ttctacctagtgagtatc |
30992056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 16 - 94
Target Start/End: Complemental strand, 30992329 - 30992251
Alignment:
| Q |
16 |
agcattactcgaagaacaataacaacaacgttcaattctcatcgcgttctgctcgtcttagatcattcctttcctttgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30992329 |
agcattactcgaagaacaataacaacaacgttcaattctcatcgcgttctgctcgtcttagatcattcctttcctttgt |
30992251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University