View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_25 (Length: 298)
Name: NF12515_high_25
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_25 |
 | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 32 - 270
Target Start/End: Original strand, 30300928 - 30301166
Alignment:
| Q |
32 |
ggttttggaagatgtgatgatgaggaatgggtgttatcctcacgagagttcttatcaacatattttgtatgatttgatcgatttgaagagattttaggag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||| | ||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
30300928 |
ggttttggaagatgtgatgatgaggaatgggtgttatcctaatgagagttcttatcagcatgtgttgtatggtttgattgatttgaagagatttgaggag |
30301027 |
T |
|
| Q |
132 |
gctaaaggggttgttgagaagatggttttgaaaggttttgtggtgagttatgattcttttaagggtttggttttggggttttgtagagagggtttggttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||| |
|
|
| T |
30301028 |
gctaaaggggttgttgagaagatggttttgaagggttttgtggtgagttatgattcttttaagggtttggttttggggttttgtagagaagggttgattg |
30301127 |
T |
|
| Q |
232 |
aggatgttgattggggtgttaggagtgtggttaggatgg |
270 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30301128 |
aggaagttgattggggtgttaggagtatggttaggatgg |
30301166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 104 - 281
Target Start/End: Complemental strand, 63924 - 63747
Alignment:
| Q |
104 |
tttgatcgatttgaagagattttaggaggctaaaggggttgttgagaagatggttttgaaaggttttgtggtgagttatgattcttttaagggtttggtt |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
63924 |
tttgattgatttgaagagattttaggaggctaaaggggttgttgagaagatggttttgaaaggtttagtggtgagttatgattcttttaagggtttggtt |
63825 |
T |
|
| Q |
204 |
ttggggttttgtagagagggtttggttgaggatgttgattggggtgttaggagtgtggttaggatggtgggatttgtt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
63824 |
ttggggttttgtagagagggtttggttgaggatgttgattggggtgttaggagtatggttgggatggtgggatttgtt |
63747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University