View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_29 (Length: 249)
Name: NF12515_high_29
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 24 - 245
Target Start/End: Complemental strand, 18096008 - 18095792
Alignment:
| Q |
24 |
attggcatagtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaacaggaaaaagattggcattttca |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18096008 |
attggcattgtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaaaaggaaaaagattggcattttca |
18095909 |
T |
 |
| Q |
124 |
tcacccacatcaccctctagaaaagcaatgtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
223 |
Q |
| |
|
|||||||| | | | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18095908 |
tcacccacttga-----aaaaaaagcaaagtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
18095814 |
T |
 |
| Q |
224 |
gctgttgaagaggaagtggcca |
245 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18095813 |
gctgttgaagaggaagtggcca |
18095792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 18081613 - 18081571
Alignment:
| Q |
207 |
attggcattgtcaccttgctgttgaagaggaagtggccattcc |
249 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
18081613 |
attggcattgttaccttgttgttgaagaggaagtggccattcc |
18081571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University