View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_3 (Length: 435)
Name: NF12515_high_3
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 1e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 11 - 147
Target Start/End: Original strand, 46648955 - 46649090
Alignment:
| Q |
11 |
caaagggattggttatcatcgcgcccaaacgttctcgagtaatgtattcctcagaaatttacaaatttaaccggttgttctttctgatcggttatcctga |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
46648955 |
caaagggattggttatcattgcgcccaaacgttctctagtaatgtattcctcagaaatttacaaatttaa-cagttgttctttctgattggttatcctgt |
46649053 |
T |
|
| Q |
111 |
cagaaatggcagtttttcgcggttgaaggttcaggat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46649054 |
cagaaatggcagtttttcgcggttgaaggttcaggat |
46649090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 145 - 251
Target Start/End: Original strand, 46651057 - 46651164
Alignment:
| Q |
145 |
gatttgtaaaatcttcccttcaagcttatcagcctggtcaa-cctctgcaacaaccattcatatttttctttggtcagaatgaccacttcatcgtcatta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46651057 |
gatttgtaaaatcttcccttcaagcttatcagcctggtcaagcctctgcaacaaccattcatatttttctttggtcataatgaccacttcatcgtcatta |
46651156 |
T |
|
| Q |
244 |
ggtgcaga |
251 |
Q |
| |
|
|||||||| |
|
|
| T |
46651157 |
ggtgcaga |
46651164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University