View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_36 (Length: 236)
Name: NF12515_high_36
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 55652396 - 55652185
Alignment:
| Q |
18 |
ccctttataacaacattagaggatccatttgccttctttggagataactcatttccattttttcttttacattttctcaaatgtccacatacannnnnnn |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55652396 |
ccctttattacaacattagaggatccatttgccttctttggagataactcatttccattttttcttttacattttctcaaatgtccacatacattttttt |
55652297 |
T |
 |
| Q |
118 |
nnaggaataaatgtccacatacatctctacctttaaatatatatannnnnnnaaattctttttctccat-ctttaaatgaatggggaaaattgcaataga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
55652296 |
ttaggaataaatgtccacatacatctctacctttaaatatatatatttttttaaattctttttctccatcctttaaatgaatggggaaaattgcaacaga |
55652197 |
T |
 |
| Q |
217 |
ctttcatctcac |
228 |
Q |
| |
|
||||||| |||| |
|
|
| T |
55652196 |
ctttcatgtcac |
55652185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University