View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_high_4 (Length: 433)
Name: NF12515_high_4
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 18 - 420
Target Start/End: Original strand, 11298933 - 11299335
Alignment:
| Q |
18 |
agtagcactttttcccacaactgatttcccaagaactagtacattcaaagaatggttcaaaatttctcccctagcttcaagattgaaagcactttcctca |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11298933 |
agtagcactttttcccacacctgatttcccgagaactagtacattcaaagaatggttcaaaatttctcccctagcttcaagattgaaagcactttcctca |
11299032 |
T |
 |
| Q |
118 |
gcagcattaagattgaatatttgactagtttgtcttggatcccttccagcagcaataagggttaacctttgaagcacttgggctgcaattgattcctgtg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11299033 |
gcagcattaagattgaatatttgactagtttgtcttggatcccttccagaagcaataagggttaacctttgaagcacttgggctgcaattgattcctgtg |
11299132 |
T |
 |
| Q |
218 |
tagtcaaaccaagccttagaaatagtctcaagaatttgattctgatttgctgcaatttctccaatttcattttttcttcttcattcaattggttatcaat |
317 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11299133 |
tagtcaaaccaagccttagaactagtctcaagaatttgattctgatttgctgcaatttctccaatttcattttttcttcttcattcaattggttatcaac |
11299232 |
T |
 |
| Q |
318 |
aacaacgacattgttttgttccacttcaattgttgatcttactcctttcaaaagggtggccaaggctgaagaatcaaacacttgcttccctccattgttg |
417 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11299233 |
aacaacgacattgttttgttccacatcaattgttgatcttactcctttcaaaagggtggccaaggctgaagaatcaaacacttgcttccctccattgttg |
11299332 |
T |
 |
| Q |
418 |
ttc |
420 |
Q |
| |
|
||| |
|
|
| T |
11299333 |
ttc |
11299335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University