View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12515_low_2 (Length: 570)
Name: NF12515_low_2
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12515_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 486; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 486; E-Value: 0
Query Start/End: Original strand, 55 - 556
Target Start/End: Complemental strand, 2783689 - 2783188
Alignment:
| Q |
55 |
ttcaatttcaaaccgaacaaaaattacggacaactatctcatttcattctcaccggaaccctaacaaatctccggcgaacatcaccgtcgtccatggcgt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2783689 |
ttcaatttcaaaccgaacaaaaattacggacaactatctcatttcattctcaccggaaccctaacaaatctccggcgaacattgccgtcgtccatggcgt |
2783590 |
T |
|
| Q |
155 |
tcttctccaccgtctccacacaatccctccaccaacactgaacttcccttcctcctcttccgttcaccggaaatggcaaatgcgccaccgtccggtaacc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783589 |
tcttctccaccgtctccacacaatccctccaccaacactgaacttcccttcctcctattccgttcaccggaaatggcaaatgcgccaccgtccggtaacc |
2783490 |
T |
|
| Q |
255 |
ttactccggtctcgttaatctgttgaagcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcgaagggaggacaatgctt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783489 |
ttactccggtctcgttaatctgttgaagcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcgaagggaggacaatgctt |
2783390 |
T |
|
| Q |
355 |
gttggagaagctttggaggtgtattcgaacggttttctttgttgttgcattggtggtttcgcttattgttacgtcgcttccggtggttgttgcggtggtt |
454 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783389 |
gttggagaagctttggaggtgtattcgaacggttttctttgttgttgcattggtggtttcgctgattgttacgtcgcttccggtggttgttgcggtggtt |
2783290 |
T |
|
| Q |
455 |
gatgttcttgttccgtgtgttttgatctccaattttacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactctttcaagagttctttga |
554 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783289 |
gatgttcttgttccgtgtgttttgatctccaattttacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactctttcaagagttctttga |
2783190 |
T |
|
| Q |
555 |
tg |
556 |
Q |
| |
|
|| |
|
|
| T |
2783189 |
tg |
2783188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University